View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4030_low_9 (Length: 463)
Name: NF4030_low_9
Description: NF4030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4030_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 14 - 387
Target Start/End: Original strand, 25413987 - 25414359
Alignment:
| Q |
14 |
catagggagatcatgccagaaagaggagattgaagatggtcggttggtgtctaataattcaaggaactctaatcaatctgaaggcagtagaggttctttt |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25413987 |
cataggaagatcatgccagaaagaggagattgaagatggtcggttggtgtctaataattcaaggaactctaatcaatctgaaggcagtagaggttctttt |
25414086 |
T |
 |
| Q |
114 |
gcattccctgagtaagttaatattatcagtgttgtaataattttcttatggcaaaaatgcatcttctataataatagctacttagtttacaataccctaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
25414087 |
gcattccctgagtaagttaatattatcagtgttgtaataattttcttatggcaaaaatgcatctataataataatagcaacttagttaacaataccctaa |
25414186 |
T |
 |
| Q |
214 |
accctaaaccctataacatgaatagattctgtaggagccagaatttcattcaatggttgaaatccgacaaatctgtgattgcataatatttttggaaact |
313 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25414187 |
accctaaaccctataacat-aatagattatgtagcagccagaatttcattcaatggttgaaatccgacaaatctgtgattgaataatatttttggaaact |
25414285 |
T |
 |
| Q |
314 |
gggttgtaaggttagactgtcccggctacaaaacttttaaaacatctccctcacgcgtaagacatgacatttgg |
387 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25414286 |
gggttgtaaggttagactgtctccgctacaaaacttttaaaacatctccctcacgcgtaagacatgacatttgg |
25414359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University