View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4031_low_4 (Length: 247)
Name: NF4031_low_4
Description: NF4031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4031_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 10554188 - 10553988
Alignment:
| Q |
1 |
cccaacatccttgtagactaacaaggatcacatcacgatagagaatatttataaagacattaaagcacatcaatagtagcgacatgggagtaacccccga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10554188 |
cccaacatccttgtagactaacaaggatcacatcacgatagagaatatatataaagacattaaagcacatcaatagtagcgacatgggagtaacccccga |
10554089 |
T |
|
| Q |
101 |
gtcaaagatccataaagaagagaaccctaatcatctctttctcttatctcctatatatagaaatctcaagctaacccttattcattcactttttccccca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10554088 |
gtcaaagatccataaagaagagaaccctaatcatc------tcttatctcctatatatagaaatctcaagctaacccttattcattcactttttccccca |
10553995 |
T |
|
| Q |
201 |
gaataat |
207 |
Q |
| |
|
|||||| |
|
|
| T |
10553994 |
aaataat |
10553988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University