View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4031_low_6 (Length: 208)
Name: NF4031_low_6
Description: NF4031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4031_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 24948506 - 24948604
Alignment:
| Q |
1 |
aaatgttaacgagaaaacaaagagaacccagatagcataatcctcaaataatcaatttggtaaagtaaaaatacgatcttgaaaacatgcaatgtaacg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24948506 |
aaatgttaacgagaaaacaaagagaacccagatagcataatcctcaaataatcaatttggtaaagtaaaaatacgattttgaaaacatgcaatgtaacg |
24948604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 24943305 - 24943388
Alignment:
| Q |
1 |
aaatgttaacgagaaaacaaagagaacccagatagcataatcctcaaataatcaatttggtaaagtaaaaatacgatcttgaaa |
84 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24943305 |
aaatgttaatgagaaaataaagagaacccagatagcataatccccaaataatcaattttgtaaagtaaaaatacgatcttgaaa |
24943388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 195
Target Start/End: Original strand, 24948670 - 24948700
Alignment:
| Q |
165 |
ggtttgatggagttgattaccgagagagtga |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
24948670 |
ggtttgatggagttgattaccgagagagtga |
24948700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University