View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4032_high_28 (Length: 365)
Name: NF4032_high_28
Description: NF4032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4032_high_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 230
Target Start/End: Complemental strand, 45855462 - 45855243
Alignment:
| Q |
11 |
cacagatcatgaaattttgatgtacctctacaacacatgtcacgtccttctattcaaaatcgctatgctcgggaagttgtaagtttgtaactagacgagt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45855462 |
cacagatcatgaaattttgatgtacctctacaacacatgtcacgtccttctattcaaaatcgctatgctcgggaagttgtaagtttgtaactagacgagt |
45855363 |
T |
|
| Q |
111 |
tgaaaggttggctgggaagccactagggatgtggtgaggtataccaacatttccggtagtaaccaacaaagtagatagtaccgcttgaagagaggaaact |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45855362 |
tgaaaggttggctgggaagccactagggatgtggtgaggtataccaacatttccggtagtaaccaacaaagtagatagtaccgcttgaagagaggaaact |
45855263 |
T |
|
| Q |
211 |
ttgtctttaagttgagcatt |
230 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45855262 |
ttgtctttaagttgagcatt |
45855243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University