View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4032_high_43 (Length: 249)
Name: NF4032_high_43
Description: NF4032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4032_high_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 54456815 - 54457049
Alignment:
| Q |
1 |
tgcggcggatagagttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54456815 |
tgcggcggatagagttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattc |
54456914 |
T |
|
| Q |
101 |
tacaccgatgatgatgatgaaccctgttgctgttgatgcttcacaaccacctgaaatcaaacattttccacagaccagtggcaaggacaaagttattcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
54456915 |
tacaccgatgatgatgatgaaccctgttgctgttgatgcttcacaaccacctgaaatcaaacattttccacagaccagtgacaaggacaaagttattcta |
54457014 |
T |
|
| Q |
201 |
ttggtcagtttcgtaactttttctattctcttctc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
54457015 |
ttggtcagtttcgtaactttttctattctcttctc |
54457049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 4 - 108
Target Start/End: Original strand, 54056497 - 54056601
Alignment:
| Q |
4 |
ggcggatagagttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattctac |
103 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
54056497 |
ggcggatggagttggaggaggaagtgaggagggagcttgcaatggagggggcgtttggaaccatgcagaggcctctcaattctctatggtcaaattctac |
54056596 |
T |
|
| Q |
104 |
accga |
108 |
Q |
| |
|
||||| |
|
|
| T |
54056597 |
accga |
54056601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 173 - 234
Target Start/End: Original strand, 54056600 - 54056661
Alignment:
| Q |
173 |
gaccagtggcaaggacaaagttattctattggtcagtttcgtaactttttctattctcttct |
234 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| | || ||||||| ||| |||| |
|
|
| T |
54056600 |
gacctgtgacaaggacaaagttattctattggtcagtttcattacgttttctactcttttct |
54056661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 15039966 - 15039895
Alignment:
| Q |
1 |
tgcggcggatagagttggaggatgaagtgaggagggagcttgcaatggagggggcgtttggaactatgcaga |
72 |
Q |
| |
|
|||||| || ||| |||||||| || ||| |||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
15039966 |
tgcggcagaaagaattggaggaggaggtgtggagggagcttgcaatggagaggacgtttggaaccatgcaga |
15039895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 15039809 - 15039756
Alignment:
| Q |
182 |
caaggacaaagttattctattggtca-gtttcgtaactttttctattctcttct |
234 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||| ||||||||||||||||||||| |
|
|
| T |
15039809 |
caaggacaaaattattctattggtaaagtttcataactttttctattctcttct |
15039756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University