View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4032_low_23 (Length: 410)
Name: NF4032_low_23
Description: NF4032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4032_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 14 - 394
Target Start/End: Original strand, 4244230 - 4244601
Alignment:
| Q |
14 |
agattaacttgaatttaaactagatatcacctggtaaattagaagtgacatgaagtactatctcatttgattgcttttgtctaagatacgcattaaatgc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4244230 |
agattaacttgaatttaaactagatatcacatggtaaattagaagtgacatgaagtactatctcatttgattgcttttgtctaagatacgcattaaatgc |
4244329 |
T |
|
| Q |
114 |
tatcaagatagtgaagcaaacaaaaatcttaaacatacatagaccaaagaacattgtgattgtgctatgttatttgctatcaaga--nnnnnnnnaggga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
4244330 |
tatcaagatagtgaagcaaacaaaaatcttaaacatacatagaccaaagaac------attgtgctatgttatttgctatcaagattttttttttaggga |
4244423 |
T |
|
| Q |
212 |
ttgctatcaagatttaannnnnnncacttaaaatagtactatatatataagtcagaatgttgactttcatttcggttgtaggacaaatttctcgaatacc |
311 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4244424 |
ttgctatcaagatttaatttttttcacttaaaata-----ctatatataagtcagaatgttgactttcatttcggttgtaggacaaatttctcgaatacc |
4244518 |
T |
|
| Q |
312 |
caactcacatgagcaaacaatgattacaaattccctgttatatcagattgaaaacgatatctcgatatcaaattgctcctcct |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4244519 |
caactcacatgagcaaacaatgattacaaattccctgttatatcagattgaaaacgatatctcgatatcaaattgctcctcct |
4244601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University