View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4032_low_43 (Length: 258)
Name: NF4032_low_43
Description: NF4032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4032_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 5452389 - 5452146
Alignment:
| Q |
1 |
gtatcatagccattatttgatttggtatgcaagcggaagtgggattatagtgttggatcaagtatattgatgttggatattcacatttgagtggagagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5452389 |
gtatcatagccattatttgatttggaatgcaagcggaagtgggattatagtgttggatcaagtatattgatgttggatattcacatttgagtggagagtt |
5452290 |
T |
 |
| Q |
101 |
tgagtggctagtcccaaattaactatcaattgacaaaatgtcgaatatataggagattttaattcacatacttcatgccttaaaattttggaggaagagt |
200 |
Q |
| |
|
||| || |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5452289 |
tga---gcaagtcccaaattaactatcaattgacaaaatgttgaatatataggaga-tttaattcacatacttcatgccttacgattttggaggaagagt |
5452194 |
T |
 |
| Q |
201 |
ggtgtctctctcatgtggtcatggaacgttaactcgtttttacctttg |
248 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
5452193 |
ggtgtctctctcatgcggtcatggagcgttaactcgtttttacctttg |
5452146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University