View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4032_low_48 (Length: 247)
Name: NF4032_low_48
Description: NF4032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4032_low_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 9 - 86
Target Start/End: Original strand, 40384785 - 40384862
Alignment:
| Q |
9 |
gatatgaatgagaatcagctgcaagtagtagtgatccctcttcaaaatgttgttgatatcgaaactacaatggagaat |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40384785 |
gatatgaatgagaatcagctgcaagtagtagtgatccctcttcaaaatgttgttgatatcgaaactacaatggagaat |
40384862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 154 - 228
Target Start/End: Original strand, 40384930 - 40385004
Alignment:
| Q |
154 |
gttgagaagtttgatgaattgaagggatacttgtgcacgtgtgatgtctttctttctaaaatgtctcactctgat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40384930 |
gttgagaagtttgatgaattgaagggatacttgtgcacgtgtgatgtctttctttctaaaatgtctcactctgat |
40385004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University