View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4032_low_48 (Length: 247)

Name: NF4032_low_48
Description: NF4032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4032_low_48
NF4032_low_48
[»] chr8 (2 HSPs)
chr8 (9-86)||(40384785-40384862)
chr8 (154-228)||(40384930-40385004)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 9 - 86
Target Start/End: Original strand, 40384785 - 40384862
Alignment:
9 gatatgaatgagaatcagctgcaagtagtagtgatccctcttcaaaatgttgttgatatcgaaactacaatggagaat 86  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40384785 gatatgaatgagaatcagctgcaagtagtagtgatccctcttcaaaatgttgttgatatcgaaactacaatggagaat 40384862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 154 - 228
Target Start/End: Original strand, 40384930 - 40385004
Alignment:
154 gttgagaagtttgatgaattgaagggatacttgtgcacgtgtgatgtctttctttctaaaatgtctcactctgat 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40384930 gttgagaagtttgatgaattgaagggatacttgtgcacgtgtgatgtctttctttctaaaatgtctcactctgat 40385004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University