View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4032_low_58 (Length: 215)
Name: NF4032_low_58
Description: NF4032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4032_low_58 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 31 - 171
Target Start/End: Original strand, 1581147 - 1581287
Alignment:
| Q |
31 |
ttcatggatttaaatattttgtcgtttatgatcaaaaacgagatgacgacgattgcgagaaagaatgtccttgggcgataaatgaatatggaccgtgtaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1581147 |
ttcatggatttaaatattttgtcgtttatgatcaaaaacgagatgacgacgattgcgagaaagaatgtccttgggcgataaatgaatatggaccgtgtaa |
1581246 |
T |
|
| Q |
131 |
ggagaagccaggaaatgttatagaatgttatcagtataatt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1581247 |
ggagaagccaggaaatgttatagaatgttatcagtataatt |
1581287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University