View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4033_high_25 (Length: 311)
Name: NF4033_high_25
Description: NF4033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4033_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 21 - 302
Target Start/End: Complemental strand, 43097659 - 43097375
Alignment:
| Q |
21 |
cgggcacccactgaaaagaaagttagtagcaatactgagcttaagactgagtaaaataccccacaactctgtatgtgtgatggtacaaatctccagctta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43097659 |
cgggcacccactgaaaagaaagttagtagcaatactgagcttaagactgagtaaaataccccacaactctgtatgtgtgatggtacaaatctccagctta |
43097560 |
T |
|
| Q |
121 |
gcagcaacacatgacaccaaacattgttctaagatgtttcctaagcacgacacaacaagatgcatgcatagtcagattttgtaatttcgccatcgtagtt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43097559 |
gcagcaacacatgacaccaaacattgttctgagatgtttcctaagcacgacacaacaagatgcatgcatagtcagatgttgtaatttcgccatcgtagtt |
43097460 |
T |
|
| Q |
221 |
aagcttcatccaactcgtatttggaggataaaaaggaattacttgacacctatcgtgtga---tccttatacatgtaagtattat |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
43097459 |
aagcttcatccaactcgtatttggaggataaaaaagaattacttcacacctatcgtgtgatcttctttatacatgtaagtattat |
43097375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University