View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4033_high_27 (Length: 266)

Name: NF4033_high_27
Description: NF4033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4033_high_27
NF4033_high_27
[»] chr5 (1 HSPs)
chr5 (1-250)||(3938792-3939018)
[»] chr7 (3 HSPs)
chr7 (79-141)||(12485932-12485994)
chr7 (79-141)||(12507364-12507426)
chr7 (79-141)||(12658250-12658312)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 3938792 - 3939018
Alignment:
1 tgtctacttagtcatgctcatgcgtgacgcttccttgcccatccgatcattccgtctcaaatgtggcttcattcaaatatgtgatccatatgatatcaat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||                  |||||| ||||||||||||||||||||||    
3938792 tgtctacttagtcatgctcatgcgtgacgcttccttgcccatccgatcattcc------------------ttcaaagatgtgatccatatgatatcaat 3938873  T
101 cgattcatttctgttgctgtaaaacgaggaattgataatcttaccttaccttagacttgtctggcactgatgatgattttcaaatccgattggatcctat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||||||||||||||||||||||    
3938874 cgattcatttctgttgctgtaaaacgaggaattgataatctta-----ccttagacttgtctggcactgatgatgattttcaaatccgattggatcctat 3938968  T
201 aatttccactgtttttaattgcaggaaccttgtggttctcaagttgaagt 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
3938969 aatttccactgtttttaattgcaggaaccttgtggttctcaagttgaagt 3939018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 141
Target Start/End: Original strand, 12485932 - 12485994
Alignment:
79 atgtgatccatatgatatcaatcgattcatttctgttgctgtaaaacgaggaattgataatct 141  Q
    |||||||||| ||||||||||||||||  || |||||||||| |||  ||||||||| |||||    
12485932 atgtgatccacatgatatcaatcgatttgttcctgttgctgtcaaaaaaggaattgagaatct 12485994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 141
Target Start/End: Original strand, 12507364 - 12507426
Alignment:
79 atgtgatccatatgatatcaatcgattcatttctgttgctgtaaaacgaggaattgataatct 141  Q
    |||||||||| ||||||||||||||||  || |||||||||| |||  ||||||||| |||||    
12507364 atgtgatccacatgatatcaatcgatttgttcctgttgctgtcaaaaaaggaattgagaatct 12507426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 141
Target Start/End: Original strand, 12658250 - 12658312
Alignment:
79 atgtgatccatatgatatcaatcgattcatttctgttgctgtaaaacgaggaattgataatct 141  Q
    |||||||||| ||||||||||||||||  || |||||||||| |||  ||||||||| |||||    
12658250 atgtgatccacatgatatcaatcgatttgttcctgttgctgtcaaaaaaggaattgagaatct 12658312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University