View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4033_high_32 (Length: 229)

Name: NF4033_high_32
Description: NF4033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4033_high_32
NF4033_high_32
[»] chr1 (1 HSPs)
chr1 (14-213)||(1590986-1591184)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 213
Target Start/End: Original strand, 1590986 - 1591184
Alignment:
14 agagaagaagagagaagtgagattgaaaatgaatgaannnnnnnnctttcttctggttttggatgaggaattatgagagggtatgaaggggtatatatat 113  Q
    |||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1590986 agagaagaagagagaagtgagattgaaaatgaatgaattttttt--tttcttctggttttggatgaggaattatgagagggtatgaaggggtatatatat 1591083  T
114 gtgtcaaaagtggatacgaggctaaaataaaacaagaggaaaatactctttg-tttgaagtggaagaattgaaagtgatgtatatgctgcatgtttcact 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
1591084 gtgtcaaaagtggatacgaggctaaaataaaacaagaggaaaatactctttgttttgaagtggaagaattgaaagtgatgtatatgctgcatgtttcact 1591183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University