View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4033_high_38 (Length: 207)
Name: NF4033_high_38
Description: NF4033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4033_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 13251760 - 13251562
Alignment:
| Q |
1 |
gttgttgcaattctcatatattttatcatgtaatagtgcttttcaacttagagccaattttagtataaaacaaaacttagagccaatttgagtaaaaatc |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13251760 |
gttgttgcaattctcatatgttttatcatgtaatagtgcttttcaacttagagccaattttagtataaaacaaaacttagagccaatttgagtaaaaatc |
13251661 |
T |
 |
| Q |
101 |
tctaaaagcacttgtgcgaagaatcttgaaatagttgagttttttaaataacat-cttgtagtagtcaaagttaccttctagatctatacacaggttct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||||| ||||||| |
|
|
| T |
13251660 |
tctaaaagcacttgtgcgaagaatcttgaaatagttgagttttttaaataacatccttgtagtggtcaaatttaccttctagatctatacagaggttct |
13251562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University