View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4033_low_10 (Length: 455)
Name: NF4033_low_10
Description: NF4033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4033_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 51 - 372
Target Start/End: Complemental strand, 30984400 - 30984078
Alignment:
| Q |
51 |
ggtaagaagggtggtagagggaggttcaagccgggttgttatattttatgatggaataattcacttcatttgtaaactttttctcatattgactgactgg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
30984400 |
ggtaagaagggtggtagagggaggttcaagccaagttgttatattttatgatggaataattcacttcatttgtaaactttttctcacattgactgaccga |
30984301 |
T |
|
| Q |
151 |
aaactttacattgcagatcatgactccttttctgacggccaaacttgctggtaagtatgttgccgtggacgcagctggcttattgatgtctacaatgcaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30984300 |
aaactttacattgcagatcatgactccttttctgacggccaaacttgctggtaagtatgttgccgtggacgcagctggcttattgatgtctacattgcaa |
30984201 |
T |
|
| Q |
251 |
gtaagattcccttctctaacagtgtgaagacgggcatgactgtctac-nnnnnnncgataaaactagcagaactgataaaattttatgcaattttttgac |
349 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30984200 |
gtaagattcccttgtctaacagtgtgaagatgggcatgactgtctacttttttttcgataaaactagcagaactgataaaattttatgcaattttttgac |
30984101 |
T |
|
| Q |
350 |
agtattcagttatttgattaagc |
372 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30984100 |
agtattcagttatttgattaagc |
30984078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 160 - 237
Target Start/End: Complemental strand, 30941162 - 30941085
Alignment:
| Q |
160 |
attgcagatcatgactccttttctgacggccaaacttgctggtaagtatgttgccgtggacgcagctggcttattgat |
237 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| |||||||| |||||||| ||||| ||||| || |||||||| |
|
|
| T |
30941162 |
attgcagatcatgactccttttcttacagccaaactagctggtaaatatgttgctgtggatgcagccggtttattgat |
30941085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University