View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4033_low_22 (Length: 338)
Name: NF4033_low_22
Description: NF4033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4033_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 54; Significance: 6e-22; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 279 - 332
Target Start/End: Original strand, 87787 - 87840
Alignment:
| Q |
279 |
cctgtagatgatcccaagaaggttgaccacttggttaagcttgatggtgctaag |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
87787 |
cctgtagatgatcccaagaaggttgaccacttggttaagcttgatggtgctaag |
87840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 89 - 142
Target Start/End: Original strand, 87630 - 87683
Alignment:
| Q |
89 |
ttaattcacatgtgtccgacacccttcagtccgaagtgccgatgttgatcggat |
142 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
87630 |
ttaattcacatgtgtcagacacccttcagtccgaagtgccgatgttgatcggat |
87683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 332
Target Start/End: Original strand, 107148 - 107204
Alignment:
| Q |
276 |
ctgcctgtagatgatcccaagaaggttgaccacttggttaagcttgatggtgctaag |
332 |
Q |
| |
|
|||||||||| |||||| |||||| | ||||||||||||||||||| ||||||||| |
|
|
| T |
107148 |
ctgcctgtaggtgatccgaagaagatcaaccacttggttaagcttgaaggtgctaag |
107204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University