View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4033_low_24 (Length: 324)
Name: NF4033_low_24
Description: NF4033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4033_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 13251528 - 13251209
Alignment:
| Q |
1 |
tgtaagttcttttctatttgtaaaagaactaaaagtttattttaattgagaagttcttctaagatagaagctagtccaagttagacttcagtccctttga |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13251528 |
tgtaagttcttttctattagtaaaagaactaaaagtttattttaattgagaagttcttctaagatagaagttagtccaagttagacttcagtccctttga |
13251429 |
T |
|
| Q |
101 |
aatgcagccttgtgtttcatggtacatagacattctttgcgatgtaaacttacattaatatactcgattattttgtcatctttggttcatttggaacatg |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13251428 |
aaagcagccttgtgtttcatggtacatagacattccttgcgatgtaaacttacattaatatactcgattcttttgtcatctttggttcatttggaacatg |
13251329 |
T |
|
| Q |
201 |
cttatatgcctgactcaatcgcttgaggtcttcatctgtgatcttttgtcgtagtaatgcaaagaacacatcaatgaattggagttgtagtaaacctttc |
300 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13251328 |
cttatatgcccgactcaatcgcttgaggtcttcatctgtcatcttttgtcgtagtaatgcaaagaacacatcaatgaattggagttgtagtaaacctttc |
13251229 |
T |
|
| Q |
301 |
ggctttggtagtaccttcat |
320 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
13251228 |
ggctttggtagtaccttcat |
13251209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University