View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4033_low_26 (Length: 301)
Name: NF4033_low_26
Description: NF4033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4033_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 44689913 - 44690198
Alignment:
| Q |
1 |
agcaaaggagtatgttgaaagagccattttggctagccctagtgatgctgatgctttatcactctatgctgatttaatatggcaaacagagaagaatgct |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44689913 |
agcagaggagtatgttgaaagagccattttggctagccctagtgatgctgatgctttatcactctatgctgatttaatatggcaaacagagaagaatgct |
44690012 |
T |
 |
| Q |
101 |
gatcgagctgaagtctattttgatagagctattcaaagtgatccaaatgattggtaagataaatcttaaatctatgtggattatgtcttttcctctatgc |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44690013 |
gatcgagctgaagcctattttgatagagctattcaaagtgatccaaatgattggtaagataaatcttaaatctatgtggattatgtcttttcctctatgt |
44690112 |
T |
 |
| Q |
201 |
atatacattctcctaatttttgcatgaaatttattgtttgaacatcaaactagagacattatatatgtgacatggtagatgtttat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44690113 |
atatacattctcctaatttttgcatgaaatttattgtttgaacatcaaactagagacattatatatgtgacatggtagatgtttat |
44690198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 63 - 156
Target Start/End: Complemental strand, 2306515 - 2306422
Alignment:
| Q |
63 |
tctatgctgatttaatatggcaaacagagaagaatgctgatcgagctgaagtctattttgatagagctattcaaagtgatccaaatgattggta |
156 |
Q |
| |
|
||||||| |||||||||||| ||||| |||||||||||| ||||||| || ||||||||| |||||| |||||||| || ||||||||||| |
|
|
| T |
2306515 |
tctatgcagatttaatatgggaaacaaagaagaatgctgctcgagctcaacaatattttgatcaagctatacaaagtgaccctaatgattggta |
2306422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University