View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4033_low_32 (Length: 229)
Name: NF4033_low_32
Description: NF4033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4033_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 213
Target Start/End: Original strand, 1590986 - 1591184
Alignment:
| Q |
14 |
agagaagaagagagaagtgagattgaaaatgaatgaannnnnnnnctttcttctggttttggatgaggaattatgagagggtatgaaggggtatatatat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1590986 |
agagaagaagagagaagtgagattgaaaatgaatgaattttttt--tttcttctggttttggatgaggaattatgagagggtatgaaggggtatatatat |
1591083 |
T |
 |
| Q |
114 |
gtgtcaaaagtggatacgaggctaaaataaaacaagaggaaaatactctttg-tttgaagtggaagaattgaaagtgatgtatatgctgcatgtttcact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1591084 |
gtgtcaaaagtggatacgaggctaaaataaaacaagaggaaaatactctttgttttgaagtggaagaattgaaagtgatgtatatgctgcatgtttcact |
1591183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University