View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4035_high_14 (Length: 375)
Name: NF4035_high_14
Description: NF4035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4035_high_14 |
 | |
|
| [»] scaffold0237 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 99 - 373
Target Start/End: Complemental strand, 39264084 - 39263799
Alignment:
| Q |
99 |
tgctgctgtcctatggtgttttagagtgcttcggctgtggggtggtccgagtaccgtttttggtgctgctgtcatgaccgaacagcagctgttggtgatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39264084 |
tgctgctgtcctatggtgttttagagtgcttcggctgtggggtggtccgagtaccgtttttggtgctgctctcatgaccgaacagcagctgttggtgatg |
39263985 |
T |
|
| Q |
199 |
ttttctgtctattgcgcagcatgtctgctgttgttttgatatgggcagctgctgtctatgttgggag--------------ttttgggttggaagaggca |
284 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39263984 |
ttttctgtctattgc---gcatgtctgctgttgttttgatctgggcagctgctgtctatgttgggagctttcctgggatatttttgggttggaagaggca |
39263888 |
T |
|
| Q |
285 |
tagctatgggattgaattttggtgattgtaattagaattcatagtcatagctaacccatggttgaaaatcatagcatgcaaaccgtctc |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39263887 |
tagctatgggattgaattttggtgattgtaatttgatttcatagtcatagcttacccatggttgaaaatcatagcatgcaaactgtctc |
39263799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0237 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: scaffold0237
Description:
Target: scaffold0237; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 24 - 101
Target Start/End: Original strand, 24611 - 24688
Alignment:
| Q |
24 |
aatgtattctttggtgaagggttgtgttcttgctgcagctacttggaagatcgatggctttgagtgtgcagaagctgc |
101 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24611 |
aatgtattctttggtgtagggttgtgttcttgcggcagctacttggaagatcgatggctttgagtgtgcagaagctgc |
24688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 70; Significance: 2e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 24 - 101
Target Start/End: Original strand, 29885063 - 29885140
Alignment:
| Q |
24 |
aatgtattctttggtgaagggttgtgttcttgctgcagctacttggaagatcgatggctttgagtgtgcagaagctgc |
101 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29885063 |
aatgtattctttggtgtagggttgtgttcttgcggcagctacttggaagatcgatggctttgagtgtgcagaagctgc |
29885140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 201
Target Start/End: Original strand, 20794712 - 20794749
Alignment:
| Q |
164 |
ctgctgtcatgaccgaacagcagctgttggtgatgttt |
201 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
20794712 |
ctgctgtcatgacagaacagcagctgttggtgctgttt |
20794749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 274 - 336
Target Start/End: Complemental strand, 42773454 - 42773392
Alignment:
| Q |
274 |
tggaagaggcatagctatgggattgaattttggtgattgtaattagaattcatagtcatagct |
336 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
42773454 |
tggatgaggcatagctatgggattgaattttggtgtttgtaattagatttcagagtcatagct |
42773392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 274 - 336
Target Start/End: Complemental strand, 53747744 - 53747682
Alignment:
| Q |
274 |
tggaagaggcatagctatgggattgaattttggtgattgtaattagaattcatagtcatagct |
336 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||| |||| ||||| |||| |
|
|
| T |
53747744 |
tggatgaggcatagctatgggattgaattttggtgtttgtaattagatttcagagtcacagct |
53747682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 274 - 336
Target Start/End: Complemental strand, 14185121 - 14185059
Alignment:
| Q |
274 |
tggaagaggcatagctatgggattgaattttggtgattgtaattagaattcatagtcatagct |
336 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||| || |||||||| | || |||||||||| |
|
|
| T |
14185121 |
tggatgaggcatagcaatgggattgaattttggtgtttctaattagattccagagtcatagct |
14185059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 308
Target Start/End: Original strand, 21977768 - 21977796
Alignment:
| Q |
280 |
aggcatagctatgggattgaattttggtg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21977768 |
aggcatagctatgggattgaattttggtg |
21977796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University