View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4035_high_18 (Length: 328)
Name: NF4035_high_18
Description: NF4035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4035_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 136 - 312
Target Start/End: Original strand, 38466459 - 38466646
Alignment:
| Q |
136 |
atagcaggaaaaataattatgggtaccaccacctaa-----------acctagatagatatgacccttctttttcgtattgtccttcttctaacaatacc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466459 |
atagcaggaaaaataattatgggtaccaccacctaatgtaataccttacctagatagatatgacccttctttttcgtattgtccttcttctaacaatacc |
38466558 |
T |
|
| Q |
225 |
acgtcagctcactcagttatgtctttgtaccaagtatggtatgttctttccacaatgtgtaacttcctttataatggtttcatttcat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466559 |
acgtcagctcactcagttatgtctttgtaccaagtatggtatgttctttccacaatgtgtaacttcctttataatggtttcatttcat |
38466646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 38466287 - 38466423
Alignment:
| Q |
1 |
acaatgtaaccatgttctagtcactctttttgcaacaagatcccacaatgacacaacgttcttgtgtctacgggagatgattttaaatacttttttcata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466287 |
acaatgtaaccatgttctagtcactctttttgcaacaagatcccacaatgacacaacgttcttgtgtctacgggagatgattttaaatacttttttcata |
38466386 |
T |
|
| Q |
101 |
gatgattatctcaccagatagattgctcaaccttcat |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466387 |
gatgattatctcaccagatagattgctcaaccttcat |
38466423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University