View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4035_high_19 (Length: 325)
Name: NF4035_high_19
Description: NF4035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4035_high_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 1785898 - 1786139
Alignment:
| Q |
10 |
caatgatatgaatatcattgggaaaggaacttcaggtgagcttctttttctctatgttaaaaactaaattatcagatcgcgtcgattcagcaagatttct |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||||||||| |
|
|
| T |
1785898 |
caatgaaatgaatatcattgggaaaggaacttcaggtgagcttctttttctctatgttaaaaactaaattatcggatcgcgtcgattcggtaagatttct |
1785997 |
T |
 |
| Q |
110 |
aggtcatgattcaactgctttaaactacttgaaattctggtttggtatattaaatcttaactcttctccttatcaaaccaagtgaagatattcatttatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1785998 |
aggtcatgattcaactgctttaaactgcttgaaattctggtttggtatattaaatcttaagtcttctccttaccaaaccaagtgaagatattcatttatt |
1786097 |
T |
 |
| Q |
210 |
tgcagaccttacttacctctagaccgaacatcagattgttat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1786098 |
tgcagaccttacttacctctagaccgaacatcagattgttat |
1786139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University