View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4035_high_41 (Length: 227)
Name: NF4035_high_41
Description: NF4035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4035_high_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 33166824 - 33166631
Alignment:
| Q |
13 |
agcagagagtaaggttcaccccagaggaagataaaatcctcatccaatcatggctaaatatttctaaggatgcagttgtacgggggtaaatcaaagagca |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33166824 |
agcaaagagtaaggttcaccccagaggaagataaactcctcatccaatcatggctaaatatttctaaggatgcagttgtacaggggtaaatcaaagagca |
33166725 |
T |
 |
| Q |
113 |
aatgttttttggcaaaagaattgcagatggttataatgaacattgtggtcatttctttgcaaagggcccagtacaactaaaatctcgatggtcg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33166724 |
aatgttttttggcaaaagaattgcagatggttataatgaacattgtggttatttccttgcaaagggaccagtacaactaaaatctcgatggtcg |
33166631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 22 - 155
Target Start/End: Complemental strand, 49281426 - 49281300
Alignment:
| Q |
22 |
taaggttcaccccagaggaagataaaatcctcatccaatcatggctaaatatttctaaggatgcagttgtacgggggtaaatcaaagagcaaatgttttt |
121 |
Q |
| |
|
||||||||| || ||||||||||||| |||||| || |||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||| | || |
|
|
| T |
49281426 |
taaggttcatccgagaggaagataaactcctca--ca--catggctaaatatttctacggatgcatttgta--ggggtaattcaaagagcaaatgctctt |
49281333 |
T |
 |
| Q |
122 |
tggcaaaagaattgcagatggttataatgaacat |
155 |
Q |
| |
|
| || ||| |||| || ||||||||||||||||| |
|
|
| T |
49281332 |
tagc-aaataattacaaatggttataatgaacat |
49281300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University