View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4035_high_42 (Length: 227)
Name: NF4035_high_42
Description: NF4035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4035_high_42 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 25978660 - 25978428
Alignment:
| Q |
1 |
agagttgtgtgctggaattctttacatctgttgctaattagtttgtctcttttat------tgagcnnnnnnnnaaacttggagttgtgatgtgtgtttg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
25978660 |
agagttgtgtgctggaattctttacatctgttgctaattagtttgtgtcttttatatatattgagcttttttttaaacttggagttgtgatgtgtgtttg |
25978561 |
T |
 |
| Q |
95 |
tgtttattgattgtttgtttaggaatttctatgtttccaaagtaaccgaaggtactattgaattaatccaatgattgacattggtttaggattatttgct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25978560 |
tgtttattgattgtttgtttaggaatttctatgtttccaaagtaaccgaaggtactattgaattaatccaatgattgacattggtttaggattatttgct |
25978461 |
T |
 |
| Q |
195 |
agagcttattttccaacaaggagtttgaattct |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25978460 |
agagcttattttccaacaaggagtttgaattct |
25978428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University