View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4035_high_46 (Length: 209)
Name: NF4035_high_46
Description: NF4035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4035_high_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 33166803 - 33166631
Alignment:
| Q |
16 |
cagaggaagataaaatcctcatccaatcatggctaaatatttctaaggatgcagttgtacgggggtaaatcaaagagcaaatgttttttggcaaaagaat |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33166803 |
cagaggaagataaactcctcatccaatcatggctaaatatttctaaggatgcagttgtacaggggtaaatcaaagagcaaatgttttttggcaaaagaat |
33166704 |
T |
|
| Q |
116 |
tgcagatggttataatgaacattgtggtcatttctttgcaaagggcccagtacaactaaaatctcgatggtcg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33166703 |
tgcagatggttataatgaacattgtggttatttccttgcaaagggaccagtacaactaaaatctcgatggtcg |
33166631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 43 - 137
Target Start/End: Complemental strand, 49281391 - 49281300
Alignment:
| Q |
43 |
catggctaaatatttctaaggatgcagttgtacgggggtaaatcaaagagcaaatgttttttggcaaaagaattgcagatggttataatgaacat |
137 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||| | ||| || ||| |||| || ||||||||||||||||| |
|
|
| T |
49281391 |
catggctaaatatttctacggatgcatttgta--ggggtaattcaaagagcaaatgctctttagc-aaataattacaaatggttataatgaacat |
49281300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University