View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4035_low_22 (Length: 290)
Name: NF4035_low_22
Description: NF4035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4035_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 12 - 272
Target Start/End: Complemental strand, 1414883 - 1414623
Alignment:
| Q |
12 |
agagactagactttcacaacgaagtgaatcaatattcaaatctcaaccaaaaaaggtagagagaatgtacaacaaccgaaaaacttatcacagaaggtaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1414883 |
agagactagactttcacaacgaagtgaatcaatattcaaatctcaaccaaaaaaggtagagagaatgtacaacaacggaaaaacttatcacagaaggtaa |
1414784 |
T |
 |
| Q |
112 |
atttgcgagcaaaatctttatagtctcaaaaggaaaataaaaaattgtatagaaggtaaattgttgagtttattacagaatcgaaaaacataattataat |
211 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1414783 |
atttgtgagcaaaatctttatagtctcaaaaggaaaataaaaaattgtatagaaggtaaattgttgagtttattacagaatcgaaaaacataattataat |
1414684 |
T |
 |
| Q |
212 |
aaagaaaattctaaaaagaattgccctttttatttttgaagggaaaatgaatttcccttat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1414683 |
aaagaaaattctaaaaagaattgccctttttatttttgaagggaaaatgaatttcccttat |
1414623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University