View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4035_low_29 (Length: 252)
Name: NF4035_low_29
Description: NF4035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4035_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 30478021 - 30477904
Alignment:
| Q |
119 |
catgattaggtctagttttacgctttctatgttaccataccaacctctctaatttcccctctctaaactgatttaannnnnnngcacattataattaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30478021 |
catgattaggtctagttttacgctttctatgttaccataccaacctctctaatttcccctctctaaactgatttaagttttttgcacattataattaatt |
30477922 |
T |
|
| Q |
219 |
tttaattgaagtaaaaaa |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30477921 |
tttaattgaagtaaaaaa |
30477904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 30341370 - 30341487
Alignment:
| Q |
119 |
catgattaggtctagttttacgctttctatgttaccataccaacctctctaatttcccctctctaaactgatttaannnnnnngcacattataattaatt |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30341370 |
catgattaggtctagttttactctttctatgttaccataccaacctctctaattttccctctctaaactgatttaattttttttcacattataattaatt |
30341469 |
T |
|
| Q |
219 |
tttaattgaagtaaaaaa |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30341470 |
tttaattgaagtaaaaaa |
30341487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 63
Target Start/End: Complemental strand, 30478125 - 30478077
Alignment:
| Q |
15 |
ggtcatacaatgttcttgttttgggttttatatgatactccagtcttgc |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30478125 |
ggtcatacaatgttcttgttttgggttttatatgatactccagtcttgc |
30478077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University