View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4035_low_34 (Length: 249)
Name: NF4035_low_34
Description: NF4035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4035_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 19415370 - 19415600
Alignment:
| Q |
1 |
tatagaactctggcccttgtttattaaactcctaactagaatctaacagtgaagaaatcatgataagaactaagaaatatggaaactggacttaaagata |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19415370 |
tatagaacactggcccttgtttattaaactcctaactagaatcaaacagtgaagaaatcatgataagaactaagaaatatggaaactggacttaaagata |
19415469 |
T |
 |
| Q |
101 |
gtttaagttgctctaaagataatatcgagatattataacatattctcatattctttaacatattctgctcacccttatgtgatatgaaatctcttactgg |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
19415470 |
gtttaagttgctctaaagataatat-gagatattataacatattctcatattctttaacatattctgctcaccctcatctgatatgaaatctcttactgg |
19415568 |
T |
 |
| Q |
201 |
ctcacacgtactttggctttccatccctgatttcc |
235 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
19415569 |
ctcac---tactttggctttccatccctgatttcc |
19415600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University