View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4036_low_4 (Length: 234)
Name: NF4036_low_4
Description: NF4036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4036_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 55 - 219
Target Start/End: Original strand, 8756734 - 8756898
Alignment:
| Q |
55 |
cgaagtgattaaactcttgtgtttaatgagctctaattagagacaaatcgttcgagagaacctcagtttgaatcctagttagatcaatcatttgtcatac |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8756734 |
cgaagtgattaaactcttgtgtttaatgagctctgattagagacaaatcgttcgagagaatctcagtttaaatcctagttagatcaatcatttgtcatac |
8756833 |
T |
 |
| Q |
155 |
ttcacttacctctggatcgaatttcagattaggatggtttcttttccttggaaaccggaagaata |
219 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8756834 |
ttcacttacctctggatcgaatttcaaattacgatggtttcttttccttggaaaccggaagaata |
8756898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University