View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4037_high_14 (Length: 234)
Name: NF4037_high_14
Description: NF4037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4037_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 84 - 225
Target Start/End: Complemental strand, 46649090 - 46648950
Alignment:
| Q |
84 |
atcctgaaccttcaaccgcgaaaaactgccatttctgtcaggataaccgatcagaaagaacaaccggttaaatttgtaaatttctgaggaatacattact |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
46649090 |
atcctgaaccttcaaccgcgaaaaactgccatttctgacaggataaccaatcagaaagaacaactg-ttaaatttgtaaatttctgaggaatacattact |
46648992 |
T |
 |
| Q |
184 |
cgagaacgtttgggcgcgatgataaccaatccctttgcttct |
225 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
46648991 |
agagaacgtttgggcgcaatgataaccaatccctttggttct |
46648950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 86
Target Start/End: Complemental strand, 46651127 - 46651057
Alignment:
| Q |
17 |
aagaaaaatatgaatggttgttgcagagg-ttgaccaggctgataagcttgaagggaagattttacaaatc |
86 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46651127 |
aagaaaaatatgaatggttgttgcagaggcttgaccaggctgataagcttgaagggaagattttacaaatc |
46651057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University