View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_high_25 (Length: 301)
Name: NF4038_high_25
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 10750865 - 10751011
Alignment:
| Q |
1 |
gctaacaataggattgtttgctttcacaaggatatagagcatgtcatcatagttgtactacatcaaggaaactgcaaatagatatggaattatgttcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10750865 |
gctaacaataggattgtttgctttcacaaggatatagagcatgtcatcatagttgtactacatgaaggaaactgcaaatagatatggaattatgttcatt |
10750964 |
T |
 |
| Q |
101 |
ttctctgtgatattgttattcgagttcaactcttttcttccttaatg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10750965 |
ttctctgtgatattgttattcgagttcaactcttttcttccttaatg |
10751011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 173 - 296
Target Start/End: Original strand, 10751036 - 10751159
Alignment:
| Q |
173 |
aataccgtaatacttttagaccgacaaacattgtcaattattaaaataaaattaactattaccttacacactacaactaatacaactactgtcacacacc |
272 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
10751036 |
aataccgtaatactcttacaccgacaaacattgtcaattattaaaataaaattaactcttaccttacacactactactaatacaactattgtcacacacc |
10751135 |
T |
 |
| Q |
273 |
acacaacatttcagaataatctac |
296 |
Q |
| |
|
|||||| |||||||||||| |||| |
|
|
| T |
10751136 |
acacaatatttcagaataaactac |
10751159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University