View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_high_29 (Length: 287)
Name: NF4038_high_29
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 72 - 263
Target Start/End: Complemental strand, 37129609 - 37129418
Alignment:
| Q |
72 |
ccacaaattaacttttatttataattaaattttagaaaacgatattgtataggtagaactatagcttgctggcaaagaatgtgaaaaaactcagtttcag |
171 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37129609 |
ccacaaattaacttttattcataattgaattttagaaaatgatattgtataggtagaactatagcttgctgccaaagaatgtgaaaaaactcagtttcag |
37129510 |
T |
 |
| Q |
172 |
aaagtannnnnnnnnnnnnnnnnnaagaagtatttgtcaaaattaaataaccggtatataaaaacacaaccaatgaaagcttataacagggg |
263 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
37129509 |
aaagtatttttttaatttttatttaagaagtatttgtcaaaattaaataaccggtatataaaaacccaaccaatgaaatcttataacagggg |
37129418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University