View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_high_30 (Length: 284)
Name: NF4038_high_30
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_high_30 |
 | |
|
| [»] scaffold0391 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 83 - 205
Target Start/End: Original strand, 4385624 - 4385746
Alignment:
| Q |
83 |
aacctaaaaaatagttttttatttataataataatcagaaggtgtttgtaattattgtttgaaaatgaaatgtaaattgtaaaaagtaaatcaatggctc |
182 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4385624 |
aacctaaaaaattgttttttatttataataataatcaaaaggtgtttgtaattattgtttgaaaatgaaatgtgaattgtaaaaagtaaatcaatggctc |
4385723 |
T |
|
| Q |
183 |
gaaacctcactcccacctcctgc |
205 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4385724 |
gaaacctcactcccacctcctgc |
4385746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 78 - 114
Target Start/End: Original strand, 39682704 - 39682740
Alignment:
| Q |
78 |
caatgaacctaaaaaatagttttttatttataataat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39682704 |
caatgaacctaaaaaatagttttttatttataataat |
39682740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0391 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0391
Description:
Target: scaffold0391; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 78 - 114
Target Start/End: Original strand, 4903 - 4939
Alignment:
| Q |
78 |
caatgaacctaaaaaatagttttttatttataataat |
114 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
4903 |
caatgaagctaaaaaatagtgttttatttataataat |
4939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University