View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_high_33 (Length: 262)
Name: NF4038_high_33
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_high_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 30957286 - 30957225
Alignment:
| Q |
1 |
tagtacttcaagtatcaaaattgcaaacacatccaaatttagtcgttttggttcttgaatat |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
30957286 |
tagtacttcaagtatcaaaattgcaaacacatccaagtttagtcggtttggttcttgaatat |
30957225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 257
Target Start/End: Complemental strand, 30935549 - 30935423
Alignment:
| Q |
123 |
caagtaaacatacatagaaatattgaaattctaatcagccnnnnnnnncctcaactctgcatcacagaggatgtgcaatgaccctgtaaggttgaggact |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||| | | | | |
|
|
| T |
30935549 |
caagtaaacatacatagaaatattgaaattctaatcagcctttttttccttcaactctgcatcacagaggacttgcaatgaccctat--------gaagt |
30935458 |
T |
|
| Q |
223 |
tgaggcaatggggtgggatctctgtctgtgctgct |
257 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||| |
|
|
| T |
30935457 |
tgcggcaatggggtgggatctctgtatgtgctgct |
30935423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 30966408 - 30966348
Alignment:
| Q |
12 |
gtatcaaaattgcaaacacatccaaatttagtcgttttggttcttgaatatgtttttagct |
72 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
30966408 |
gtatcaaaattgcaaacacatccaactttagtcggttttgttcttgaatatgtttttagct |
30966348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 12 - 82
Target Start/End: Complemental strand, 30936116 - 30936046
Alignment:
| Q |
12 |
gtatcaaaattgcaaacacatccaaatttagtcgttttggttcttgaatatgtttttagcttgtcaaatta |
82 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
30936116 |
gtatcaacattgcaaacacatccaaatttagtcagtttggttcttaaatatgtatttagctactcaaatta |
30936046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 121 - 162
Target Start/End: Complemental strand, 30965662 - 30965621
Alignment:
| Q |
121 |
cacaagtaaacatacatagaaatattgaaattctaatcagcc |
162 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
30965662 |
cacaagtaaacatacatagaaaaattggaattctaatcagcc |
30965621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University