View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_high_56 (Length: 220)
Name: NF4038_high_56
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_high_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 40818879 - 40818691
Alignment:
| Q |
17 |
agttgtaataatggttacttgagtattgatgaaaacaagatggaggagaagactatgtagtattactgaactgatgagtggaagtgaaatcagaaagata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40818879 |
agttgtaataatggttacttgagtattgatgaaaataagatggaggagaagactatgtactattactgaactgatgagtggaagtgaaatcagaaagata |
40818780 |
T |
|
| Q |
117 |
tgtttcggtgagagaggtatggtgtatggtagtgtggaagactcagaaaagacaatttaagctaattattatttttatgggattctgtg |
205 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40818779 |
tgtttcagtgagagaggtatggtgtatggtagtgtggaagactcagaaaagacaatttaagctaattattatttttatgggattctgtg |
40818691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University