View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_low_19 (Length: 370)
Name: NF4038_low_19
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 22 - 206
Target Start/End: Complemental strand, 583734 - 583550
Alignment:
| Q |
22 |
taatacatactgatctttgttcacatcaagctcagcaaatttgtcctttgcagcaggtatatccccttctccattggtttcaaaatccacataactttca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
583734 |
taatacatactgatctttgttcacatcaagctcagcaaatttgtcctttgcagtaggtatatccccttctccattggtttcaaaatccacataactttca |
583635 |
T |
 |
| Q |
122 |
tatgtaacatatacattgtcttcaaattgattgaaatttattttcccatcatgttcataatcatccatgtgcctgtcttacaaac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
583634 |
tatgtaacatatacattgtcttcaaattgattgaaatttattttcccatcatgttcataatcatccatgtgcctgtcttacaaac |
583550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 292 - 355
Target Start/End: Complemental strand, 583490 - 583427
Alignment:
| Q |
292 |
aaaagtgctcaagtttaacaaagcttacttaaatttatcattcaccatccacttcaacatttct |
355 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
583490 |
aaaaatgctcaagtttaacaaagcttacttaaatttatcattcaccatccacttcaacatttct |
583427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University