View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_low_20 (Length: 332)
Name: NF4038_low_20
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_low_20 |
 |  |
|
| [»] scaffold0054 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0054 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 62 - 135
Target Start/End: Complemental strand, 16905 - 16832
Alignment:
| Q |
62 |
acatacggtgtgcaaaatacagatcaatacaatcaatgtcatcatccaattcaactcaaaacttttgttcaagt |
135 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
16905 |
acatacggtgtgcagaatacaaatcaatacaatcaatgtcataatccaattcaactcataacttttgttcaagt |
16832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 265 - 315
Target Start/End: Complemental strand, 16704 - 16654
Alignment:
| Q |
265 |
gttgatattcactttccccttattttcaaagacaatattcctattttagtt |
315 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16704 |
gttgatagtcactttccccttattttcaaagacaatattcctattttagtt |
16654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 158 - 204
Target Start/End: Complemental strand, 16811 - 16765
Alignment:
| Q |
158 |
tctaatgagagcatatacattattctaacaaattctcttagcacttg |
204 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
16811 |
tctaatgagagcatatgcattattcacacaaattctcttagcacttg |
16765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University