View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_low_23 (Length: 319)
Name: NF4038_low_23
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_low_23 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 18 - 319
Target Start/End: Original strand, 7451182 - 7451481
Alignment:
| Q |
18 |
ggagggccatatagtgaaaagggtttgaatagattgatgcatatgggtttgtctgtacataatataggaaattcatttgtggggtaacagtacctatatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7451182 |
ggagggccatatagtgaaaagggtttgaatagattgatgcatatgggtttgtctgtacataacataggaaattcatttgtggggtaacagtacctatatt |
7451281 |
T |
|
| Q |
118 |
agtcattattatgctttcatgcattttaaaaactgaaaaatggttggtatagcttccacttgtagtacttttatgtttctaatttttgttttgagggaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7451282 |
agtcattattatgctttcatgcattttaaaaactgaaaaagggttggtatagcttccacttgtagtacttttatgtttctaatttttg--ttgagggaga |
7451379 |
T |
|
| Q |
218 |
gggtcagaggggggttctccttatgcatcatgctacaagaagcccaaaattgaactaacaacagtgtctgtttaatatagcgtttgcaaaacggagtttg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
7451380 |
gggtcagaggggggttctccttatgcatcatgctacaagaagcccaaaattgaactaacaacaatgtctgtttgatatagcgtttgcaaaatggagtttg |
7451479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University