View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_low_24 (Length: 313)
Name: NF4038_low_24
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 41825761 - 41825551
Alignment:
| Q |
17 |
cttctcctaattgcaccaccctcttcttcatccattgctttttctcccaacaactcttcactccatcttgcaacacactcatcacttcactactcaactg |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825761 |
cttctcctaattgcaccaccttcttcttcatccattgctttttctcccaacaactcttcactccatcttgcaacacactcatcacttcactactcaactg |
41825662 |
T |
 |
| Q |
117 |
ttgcatcacttgtgatggcaatgatgaaacttttcttgattttttccttaagtgatcaatattttcatcttcttcatgtccctttgaaccataaccacca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825661 |
ttgcatcacttgtgatggcaatgatgaaacttttcttgattttttccttaagtgatcaatattttcatcttcttcatgtccctttgaaccataaccacca |
41825562 |
T |
 |
| Q |
217 |
ccttctcctga |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
41825561 |
ccttctcctga |
41825551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 26919489 - 26919537
Alignment:
| Q |
46 |
atccattgctttttctcccaacaactcttcactccatcttgcaacacac |
94 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||| ||||||| |
|
|
| T |
26919489 |
atccattgctttttctcccaagtactcttacctccatcttgaaacacac |
26919537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University