View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4038_low_33 (Length: 262)

Name: NF4038_low_33
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4038_low_33
NF4038_low_33
[»] chr6 (5 HSPs)
chr6 (1-62)||(30957225-30957286)
chr6 (123-257)||(30935423-30935549)
chr6 (12-72)||(30966348-30966408)
chr6 (12-82)||(30936046-30936116)
chr6 (121-162)||(30965621-30965662)


Alignment Details
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 30957286 - 30957225
Alignment:
1 tagtacttcaagtatcaaaattgcaaacacatccaaatttagtcgttttggttcttgaatat 62  Q
    |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||    
30957286 tagtacttcaagtatcaaaattgcaaacacatccaagtttagtcggtttggttcttgaatat 30957225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 257
Target Start/End: Complemental strand, 30935549 - 30935423
Alignment:
123 caagtaaacatacatagaaatattgaaattctaatcagccnnnnnnnncctcaactctgcatcacagaggatgtgcaatgaccctgtaaggttgaggact 222  Q
    ||||||||||||||||||||||||||||||||||||||||        | |||||||||||||||||||||  |||||||||||| |        | | |    
30935549 caagtaaacatacatagaaatattgaaattctaatcagcctttttttccttcaactctgcatcacagaggacttgcaatgaccctat--------gaagt 30935458  T
223 tgaggcaatggggtgggatctctgtctgtgctgct 257  Q
    || |||||||||||||||||||||| |||||||||    
30935457 tgcggcaatggggtgggatctctgtatgtgctgct 30935423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 30966408 - 30966348
Alignment:
12 gtatcaaaattgcaaacacatccaaatttagtcgttttggttcttgaatatgtttttagct 72  Q
    ||||||||||||||||||||||||| |||||||| ||| ||||||||||||||||||||||    
30966408 gtatcaaaattgcaaacacatccaactttagtcggttttgttcttgaatatgtttttagct 30966348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 12 - 82
Target Start/End: Complemental strand, 30936116 - 30936046
Alignment:
12 gtatcaaaattgcaaacacatccaaatttagtcgttttggttcttgaatatgtttttagcttgtcaaatta 82  Q
    ||||||| |||||||||||||||||||||||||  |||||||||| ||||||| |||||||  ||||||||    
30936116 gtatcaacattgcaaacacatccaaatttagtcagtttggttcttaaatatgtatttagctactcaaatta 30936046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 121 - 162
Target Start/End: Complemental strand, 30965662 - 30965621
Alignment:
121 cacaagtaaacatacatagaaatattgaaattctaatcagcc 162  Q
    |||||||||||||||||||||| |||| ||||||||||||||    
30965662 cacaagtaaacatacatagaaaaattggaattctaatcagcc 30965621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University