View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_low_41 (Length: 249)
Name: NF4038_low_41
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 247
Target Start/End: Original strand, 25713880 - 25714110
Alignment:
| Q |
16 |
catgtatcaagtacattaatgccttcttttnnnnnnntagtactacatcaatttgctttgaatgattggaaaatgatgttaatgtcgacaatgtggtggc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25713880 |
catgtatcaagtacattaatgccttcttt-aaaaaaatagtgctgcatcaatttgctttgaatgattggaaaatgatgttaatgttgacaatgtggtggc |
25713978 |
T |
|
| Q |
116 |
actcactattttcctttgcatgaaattctttataaccgatgattataaattggttgtttcttttcttcttcttgtttgcccccaacacaattattgattt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25713979 |
actcactattttcctttgcatgaaattctttataaccgatgattataaagtggttgtttcttttcttcttcttgtttgcccccaacacaattattgattt |
25714078 |
T |
|
| Q |
216 |
ccatcatgtgtcatgtccctcttgtcattatc |
247 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |
|
|
| T |
25714079 |
ccatcatgtgtcatgtctctcttggcattatc |
25714110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University