View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_low_43 (Length: 244)
Name: NF4038_low_43
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 11 - 128
Target Start/End: Complemental strand, 51310132 - 51310015
Alignment:
| Q |
11 |
atgaacaagataagtatgttaatctatctgcttatattagtgaggaagatatgttggcacaaccttatggggacatttgcactagttagcatagattaca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
51310132 |
atgaacaagataagtatgttaatctatctgcttatattagtgaggaagatatgttggcacaaccttatggggacatttgcactagttagcatagattgca |
51310033 |
T |
|
| Q |
111 |
aattcatctcttatttag |
128 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
51310032 |
aattcatctcttatttag |
51310015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 123 - 228
Target Start/End: Complemental strand, 51309936 - 51309831
Alignment:
| Q |
123 |
atttagcagacactgcattattggattgttcataagtttatgttaatttgtatatagcaagtatgtttatgtaaacttgttttcaatttctagctctggt |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51309936 |
atttagcagacactgcattgttggattgttcataagtttatgttaatttgtatatagcaagtatgtttatgtaaacttgttttcaatgtctagctctggt |
51309837 |
T |
|
| Q |
223 |
cacaaa |
228 |
Q |
| |
|
|||||| |
|
|
| T |
51309836 |
cacaaa |
51309831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University