View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_low_54 (Length: 227)
Name: NF4038_low_54
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 46444377 - 46444598
Alignment:
| Q |
1 |
ctttttatgggcatt-acatacaacaactagccacattaactaataaaccaacaactatttgaaatttaatggcaaattgtgaagttttctgcatcttgc |
99 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46444377 |
ctttttatgggcattgacatacaacaactaaccacattaactaataaaccaacaactatttgaaatttaatggcaaattgtgaagttttctgcatcttgc |
46444476 |
T |
|
| Q |
100 |
aagccatcacctatattggtatttaccaatctttctctctcgtgagttgtcaatgttaaagtgagataacttaactcttgcatgtttttatagttgttga |
199 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46444477 |
aagccatcacctataatggtatttaccgatctttctctcttgtgagttgttaatgttaaagtgagataacttaactcttgcatgtttttatagttgttga |
46444576 |
T |
|
| Q |
200 |
atgaaatcttgtatcttggact |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46444577 |
atgaaatcttgtatcttggact |
46444598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University