View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4038_low_55 (Length: 220)
Name: NF4038_low_55
Description: NF4038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4038_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 17 - 187
Target Start/End: Original strand, 2625083 - 2625254
Alignment:
| Q |
17 |
attgtgttgccaacgtgtcaaataaatcaagagtgttgtcatgaaattgttagcattagggaggagcatttgaaaggtgtcataaatgccaactaacttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
2625083 |
attgtgttgccaacgtgtcaaataaatcaagagtgttgtcatcaaattgttaacattagggaggaacatttgaaaggtgtcataaatgccaattaacttc |
2625182 |
T |
 |
| Q |
117 |
cataaattagtagcctttgagctaac-aaagaatgtatgcatttacgtttcaccaagatcacaagaagcata |
187 |
Q |
| |
|
|||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2625183 |
cataaattagtagcctttgagcaaacaaaaaaatgtatgcatttacgtttcaccaagatcacaagaaacata |
2625254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 167
Target Start/End: Complemental strand, 33708082 - 33708042
Alignment:
| Q |
127 |
tagcctttgagctaacaaagaatgtatgcatttacgtttca |
167 |
Q |
| |
|
||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
33708082 |
tagccttcgagcaaacaaagaatgtatgcatttgcgtttca |
33708042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University