View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4040_high_2_N (Length: 347)
Name: NF4040_high_2_N
Description: NF4040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4040_high_2_N |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 68 - 323
Target Start/End: Original strand, 13759291 - 13759546
Alignment:
| Q |
68 |
ataatcatgtaaatttacctaatagacacatgcataattgcataaagccataaacatatatacacatgaatactactatgaactatgtagcaccgacact |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13759291 |
ataatcatgtaaatttacctaatagacacatgcataattgcataaagccataaacatatatacacatgaatactactatgaactatgtagcaccgacact |
13759390 |
T |
|
| Q |
168 |
tctaaccaaatgcatattcagcatctaacacatatcagtgtttggtgtcgaacacaccaaacagtgacatggcacagatagatggcagggtagatgttat |
267 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13759391 |
tctaatcaaatgcatattcagcatctaacacatatcagtgtttggtgtcgaacacaccaaacagtgacatggcacagatagatggcagggtagatgttat |
13759490 |
T |
|
| Q |
268 |
tatattcaattactttaattttctaatattaataccgatgtcttgtctaagtatcg |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13759491 |
tatattcaattactttaattttctaatattaataccgatgtcttgtctaagcatcg |
13759546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University