View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4040_low_10 (Length: 290)
Name: NF4040_low_10
Description: NF4040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4040_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 13759299 - 13759546
Alignment:
| Q |
1 |
gtaaatttacctaatagacacatgcataattgcataaagccataaacatatatacacatgaatactactatgaactatgtagcaccgacacttctaatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13759299 |
gtaaatttacctaatagacacatgcataattgcataaagccataaacatatatacacatgaatactactatgaactatgtagcaccgacacttctaatca |
13759398 |
T |
|
| Q |
101 |
aatgcatattcagcatctaacacatatcagtgtttggtgtcgaacacaccaaacagtgacatggcacagatagatggcagggtagatgttattatattca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13759399 |
aatgcatattcagcatctaacacatatcagtgtttggtgtcgaacacaccaaacagtgacatggcacagatagatggcagggtagatgttattatattca |
13759498 |
T |
|
| Q |
201 |
attactttaattttctaatattaataccgatgtcttgtctaagtatcg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13759499 |
attactttaattttctaatattaataccgatgtcttgtctaagcatcg |
13759546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University