View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4041_low_18 (Length: 237)
Name: NF4041_low_18
Description: NF4041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4041_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 62 - 221
Target Start/End: Complemental strand, 16957308 - 16957149
Alignment:
| Q |
62 |
acggtggaccaccaaatgtttaaacttatagaggcaatcgacgttgattctcaaaaacaaaagttcatgannnnnnncgtctttacaatagttgaatata |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16957308 |
acggtggaccaccaaatgtttaaacttatagaggcaatcgacgtcgattctcaaaaacaaaagttcatgatttttttcgtctttacaatagttgaatata |
16957209 |
T |
 |
| Q |
162 |
tagtaacacgatttgatataagttaaacnnnnnnnntggcagtcaagttatacttaattc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16957208 |
tagtaacacgatttgatataagttaaacaaaaaaaatggcagtcaagttatacttaattc |
16957149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University