View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4041_low_3 (Length: 458)

Name: NF4041_low_3
Description: NF4041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4041_low_3
NF4041_low_3
[»] chr5 (2 HSPs)
chr5 (20-94)||(12748966-12749040)
chr5 (20-94)||(12812046-12812120)


Alignment Details
Target: chr5 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 12748966 - 12749040
Alignment:
20 aagggctctactcacttttgatgccggaggtggctatggtttaggccatggcattgttggtggaggtcatggagg 94  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12748966 aagggctctactcacttttgatgccggaggtggctatggtttaggccatggcattgttggtggaggtcatggagg 12749040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 12812046 - 12812120
Alignment:
20 aagggctctactcacttttgatgccggaggtggctatggtttaggccatggcattgttggtggaggtcatggagg 94  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12812046 aagggctctactcacttttgatgccggaggtggctatggtttaggccatggcattgttggtggaggtcatggagg 12812120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University