View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4043_low_15 (Length: 246)
Name: NF4043_low_15
Description: NF4043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4043_low_15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 246
Target Start/End: Complemental strand, 10121015 - 10120794
Alignment:
| Q |
20 |
gtaagtccatgtgaaaaccgactaataaatgttttcacgagacttctaagaaaaggtgcatgttgtacgtgagaatgaaggtatagttacatagaagtta |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10121015 |
gtaaatccatgtgaaaaccgactaataaatgttttcacgagacttctaagaaaaggtgcatgttgtacgtgagaatgaaggtatagttacatagaagtta |
10120916 |
T |
|
| Q |
120 |
tcaaaaaggcatcaccatactctaagaataagaattcctacctgtatcaatgaaaccaacaatgatatttgcttggtttttgtttgagtatcccatattc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
10120915 |
tcaaaaaggcatcaccatactctaagaatacga-----cacctgtatcaatgaaaccaacaataacatttgcttggtttttgtttgagtatcccatattc |
10120821 |
T |
|
| Q |
220 |
tccatggtttcatcatccaaaagtccc |
246 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
10120820 |
tccatggtttcatcatccaaaagtccc |
10120794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University