View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4043_low_17 (Length: 241)
Name: NF4043_low_17
Description: NF4043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4043_low_17 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 4481047 - 4480826
Alignment:
| Q |
20 |
gaatgctggtaaatttacctttcccttcctaatgatacacaaaatttgcttactctctcatttgatgtctgaaaatatcatgatatagaattttttgata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4481047 |
gaatgctggtaaatttacctttcccttcctaatgatacacaaaattttcttactctctcatttgatgtctgaaaatatcatgatatagaattttttgata |
4480948 |
T |
|
| Q |
120 |
ttcatggtttgcaaaatttatttggcatattctcaaaggtttggttcttctcacattatgcaacgcatataattcttttttgtggaatgaggtttgttaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4480947 |
ttcatggtttgcaaaatttatttggcatattctcaaaggtttggttcttctcacattatgcaacgcatataattcttttttgtggaatgaggtttgttaa |
4480848 |
T |
|
| Q |
220 |
tgcacaagatttttgtgtggcc |
241 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4480847 |
tgcacaagatttttgtgtggcc |
4480826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 128
Target Start/End: Complemental strand, 4481158 - 4481080
Alignment:
| Q |
50 |
aatgatacacaaaatttgcttactctctcatttgatgtct-gaaaatatcatgatatagaattttttgatattcatggtt |
128 |
Q |
| |
|
||||||||| ||||||||||| || ||||||||||||| | |||||| | ||||||| |||| |||||||||| |||||| |
|
|
| T |
4481158 |
aatgatacagaaaatttgcttcctttctcatttgatgtatcgaaaat-taatgatatggaatcttttgatattgatggtt |
4481080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 61 - 142
Target Start/End: Original strand, 35538519 - 35538599
Alignment:
| Q |
61 |
aaatttgcttactctctcatttgatgtctgaaaatatcatgatatagaattttttgatattcatggtttgcaaaatttattt |
142 |
Q |
| |
|
|||| ||||| |||||||| ||||||||| |||| ||||||||||||||| || |||| ||||||||| |||||||| |||| |
|
|
| T |
35538519 |
aaatatgcttgctctctcaattgatgtctcaaaa-atcatgatatagaatattatgatgttcatggttcgcaaaattgattt |
35538599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 50 - 144
Target Start/End: Original strand, 37220975 - 37221069
Alignment:
| Q |
50 |
aatgatacacaaaatttgcttactctctcatttgatgtctgaaaatatcatgatatagaattttttgatattcatggtttgcaaaatttatttgg |
144 |
Q |
| |
|
|||||| || ||||| || || |||||||| ||||||| | |||| ||| |||| |||| | || |||||||||||||||| ||||||||||||| |
|
|
| T |
37220975 |
aatgattcagaaaatatgtttgctctctcacttgatgtgtcaaaaaatcttgatttagagtcttatgatattcatggtttggaaaatttatttgg |
37221069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University