View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4044_high_17 (Length: 288)
Name: NF4044_high_17
Description: NF4044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4044_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 5 - 270
Target Start/End: Original strand, 45862481 - 45862744
Alignment:
| Q |
5 |
ttctataacagctctagattcatcagaaatctctagcttgtagttgaagtcaggtggtggaggtttgactgaaacctttaagggtctgagagatgttttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45862481 |
ttctataacagctctagattcatcagaaatctctagcttgtagttgaagtcaggtggtggaggtttgactgaaacctttaagggtctgagagatgttttt |
45862580 |
T |
 |
| Q |
105 |
gagataaaaaatggattggttgtgaaaatggggaaggttggttttatgatgggggaatacatggaatgaatgattaagatgatgatggattctaaagata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45862581 |
gagataaaaaatggattggttgtgaaaatggggaaggttggttttatgatgggggaatacatggaatgaatgattaaggtgatgatggattctaaagata |
45862680 |
T |
 |
| Q |
205 |
ttgaagtgaaaagtggaaggaaatataatataaaacttgtgactgtgagaatttagactaacgttc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45862681 |
ttgaagtgaaaagtggaaggaaatataatataaaacttgtgactgt--gaatttagactaacgttc |
45862744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University